MCQ ON GENETICS- PART 3

MCQ ON GENETICS PART- 3

In this MCQ part, we have provided very best 76-question including molecular Genetics. Answers are with bold font.

• Plasmid vectors for cloning:

1. can generally accommodate larger inserts than phage vectors can
2. grow within bacteria, and are present in bacterial colonies on an agar plate
3. can accommodate inserts of over 100 kilobases
4. include centromeres to allow propagation in yeast
5. burst bacteria and form plaques on a “lawn” of bacteria

• Simple tandem repeat polymorphisms in humans are most useful for:

1. Solving criminal and paternity cases
2. reconstructing the relationships of humans and chimps
3. estimating relationships of humans and Neanderthals
4. transferring disease resistance factors into bone marrow cells
5. estimating matches for blood transfusions

• The polymerase chain reaction or PCR is a technique that

1. was used to demonstrate DNA as the genetic material
2. is used to determine the content of minerals in a soil sample
3. uses short DNA primers and a thermostable DNA polymerase to replicate specific DNA sequences in vitro
4. measures the ribosome transfer rate during translation
5. detects the level of polymerases involved in replication

• Positional cloning refers to:

1. using a selection procedure to clone a cDNA
2. cloning a portion of a gene using PCR
3. isolating a gene by PCR using primers from another species
4. isolating a gene from a specific tissue in which it is being expressed
5. mapping a gene to a chromosomal region and then identifying and cloning a genomic copy of the gene from the region

• Assuming Hardy-Weinberg equilibrium, the genoypte frequency of heterozygotes, if the frequency of the two alleles at the gene being studied are 0.6 and 0.4, will be:

1. 80
2. 64
3. 48
4. 32
5. 16

• Large quantities of useful products can be produced through genetic engineering involving:

1. bacteria containing recombinant plasmids
2. yeast carrying foreign genes
3. transgenic plants
4. mammals producing substances in their milk
5. all of the above

• On average, how many fragments would a restriction enzyme which recognizes a specific 4 base sequence in DNA is expected to cleave a double-stranded bacteriophage with a genome size of 5,000 bp into?

1. about 2
2. about 4
3. about 20
4. about 50
5. about 1250

• The “sticky ends” generated by restriction enzymes allow:

1. selection for plasmids lacking antibiotic resistance
2. easy identification of plasmids which carry an insert
3. replication of transfer RNA within the bacterial cell
4. insertion of centromeres into ribosomes lacking them
5. pieces of DNA from different sources to hybridize to each other and to be joined together

• QTL (Quantitative trait locus) analysis is used to:

1. identify RNA polymerase binding sites
2. map genes in bacterial viruses
3. determine which genes are expressed at a developmental stage
4. identify chromosome regions associated with a complex trait in a genetic cross
5. determine the most rapidly-evolving parts of genes

• The likelihood of an individual in a population carrying two specific alleles of a human DNA marker, each of which has a frequency of 0.2, will be:

1. 4
2. 32
3. 16
4. 08
5. 02

• A threshold trait is one which:

1. is expressed on a continuous scale (such as blood pressure)
2. is present in a few discrete classes, but is influenced by both genetics and the environment (such as diabetes or schizophrenia)
3. is caused by only a single gene, with no environmental influence
4. is present in a very low frequency in the population
5. is associated with superior survival of the heterozygote

• The stretch of codons between AUG and a stop codon is called

1. Open reading frame
2. TATA box
3. Colinearity
4. Degenerate
5. None of these

• Mitochondrial DNA is advantageous for evolutionary studies because:

1. it is inherited only through the female parent and thus evolves in a way that allows trees of relationship to be easily constructed
2. it is inserted into the X chromosome
3. it first appeared in humans and is not found in other animals
4. it evolves more slowly than the genes in the nucleus
5. it was derived from the globin genes as an extra copy

• What are the assumptions of Hardy Weinberg equilibrium?

1. Small population size, random mating, no selection, no migration, no mutation
2. large population size, random mating, no selection, no migration, no mutation
3. large population size, random mating, heterozygotes survive the best, no migration, no mutation
4. large population size, like individuals’ mate, no selection, no migration, no mutation
5. large population size, random mating, no selection, migrants enter from other populations, no mutation

• HbA and HbS alleles of normal and sickle cell haemoglobin are

1. Co-dominant alleles
2. Multiple alleles
3. Dominant-recessive alleles
4. Cumulative alleles
5. Both A & B

Read also… DIFFERENCE BETWEEN GENE AND ALLELE

• Alleles which govern different expression of the same character and exhibit cis-trans position effect:

1. Multiple alleles
2. Duplicate alleles
3. Pseudo alleles
4. Identical alleles

• Typical di-hybrid ratio for a single trait is:

1. 3:2:1
2. 9:3:3:1
3. 9:3:2:1
4. 1:2:1
5. 9:7

• Twin studies in humans are useful because:

1. they allow more refined estimates of chromosome location to be made
2. twins have a greater likelihood of being heterozygous
3. they allow improved expression of genes
4. Cloning of genes is facilitated by the presence of extra copies.
5. They allow genetic as opposed to environmental influences on variation in a trait to be estimated.

• Which of the following statements about heritability are true?

1. is a measure of level of gene linkage
2. is a measure of inbreeding
3. is a measure of proportion of repeated DNA in an organism
4. is a measure of the level of heterozygotes in a population
5. is a measure of the proportion of variation that is due to genetic causes.

• Linkage between two or more either dominant or recessive allele is referred to:

1. Repulsion
2. Crossing over
3. Gene interaction
4. Coupling
5. coincidence

• The allele associated with sickle cell anemia apparently reached a high frequency in some human populations due to:

1. random mating
2. superior fitness of heterozygotes in areas where malaria was present
3. migration of individuals with the allele into other populations
4. a high mutation rate at that specific gene
5. genetic drift

• The “cri-du-chat” syndrome is caused by change in chromosome structure involving

1. Deletion
2. Duplication
3. Inversion
4. Translocation
5. Transfusion

• Inversion refers to:

1. Loss of a segment of a chromosome
2. A chromosome segment present in more than two copies in the same nucleus
3. Structural change in a chromosome in which a segment is oriented in a reverse order
4. One way or reciprocal transfer of segments between non homologous chromosome
5. None of these

See also… TYPES OF CHROMOSOME-STRUCTURE&DEFINITION

• An increase in the inbreeding coefficient, F, is likely to result in:

1. reduced likelihood of heterozygotes being present in a population
2. higher proportion of genes that show linkage
3. higher proportion of genes with introns
4. lower level of difference between proteins in two daughter cells
5. higher level of difference between RNA molecules in two daughter cells

• If the frequency of males affected with an X-linked recessive condition in a human population is .10 (one in ten), what will be the expected frequency of affected females?

1. 0001
2. .001
3. .02
4. .01
5. .05

• The following genotypes are found in a population: AA/70, Aa/50 aa /20, What are the allele frequencies of A and a?

1. A = 0.86 and a = 0.14
2. A = 0.68 and a = 0.32
3. A = 0.63 and a = 0.36
4. A = 0.32 and a = 0.68
5. A = 0.36 and a = 0.63

• “A” represents the dominant allele and “a” represents the recessive allele of a pair. If, in 1000 offspring, 500 are aa and 500 are of some other genotype, which of the following are most probably the genotypes of the parents?

1. Aa and Aa
2. Aa and aa
3. AA and Aa
4. AA and aa
5. aa and aa

• A form of vitamin D-resistant rickets, known as hypophosphatemia, is inherited as an X-linked dominant trait. If a male with hypophosphatemia marries a normal female, which of the following predictions concerning their potential progeny would be true?

1. All of their sons would inherit the disease
2. All of their daughters would inherit the disease
3. About 50% of their sons would inherit the disease
4. About 50% of their daughters would inherit the disease
5. None of their daughters would inherit the disease

• Which of the following best describes the parents in a testcross?

1. One individual has the dominant phenotype and the other has the recessive phenotype.
2. Both individuals are heterozygous.
3. Both individuals have the dominant phenotype.
4. Both individuals have the recessive phenotype.
5. Both individuals have an unknown phenotype.

• A cross between an inbred line and an open pollinated variety is called?

1. Back cross
2. Test cross
3. Top cross
4. Inbred varieties cross
5. Both C & D

• The ability of a gene to have multiple phenotypic effects is known as

1. Pleiotropy
2. Co-dominance
3. Incomplete dominance
4. Complete dominance
5. Mutation

• Type of gene interaction which provide ratio of 9:3:4?

1. Masking gene action
2. Duplicate gene action
3. Supplementary gene action
4. Complementary gene action
5. Inhibitory gene action

• DNA replication can be described as

1. Semiconservative
2. Conservative
3. Degenerative
4. Dispersive
5. Radica

• If the sequence of bases in DNA is TACCGACCA, then the sequence of codons on the transcript will be

1. ATGGCTGGT
2. ATCCGAACU
3. AUGGCUGGU
4. AUGGACUAA

• What would be the sequence of bases of an mRNA molecule that was transcribed from the sequence of DNA bases- GTAGTAGGT

1. GTAGTAGGT
2. CAUCAUCCA
3. UCGUCGUUC
4. AUGAUGAAU
5. CATCATCCA

• If a double stranded DNA has 20% Thymine, the percentage of Guanine in the DNA

1. 30%
2. 10%
3. 90%
4. 40%

• If a DNA contains 1000 base pairs, what would be its length?

1. 3400 Å
2. 34000 Å
3. 6800
4. 1000 Å

• What is not True for DNA in prokaryotes

1. Present in the form of a compact structure called nucleoid
2. the coils are maintained by non-histone basic proteins
3. found in cytoplasm in a supercoiled condition
4. packaged as nucleosomes along with histones

• Hershey and Chase experiment proving DNA as the genetic material was based on the principle

1. Transduction
2. Transformation
3. Transcription
4. Translation

• A bacterial colony containing DNA made up of 100% N15 nitrogen bases is allowed to replicate in a medium containing N14 bases. After one round of replication the result would be

1. All individuals will be identical to parents
2. All individuals will be hybrids
3. Only 50% individuals would be hybrids
4. All individuals would have DNA made up of 100% N¹⁴

• Teminism is

1. a central dogma reverse
2. a central dogma of molecular biology
3. a circular flow of hereditary material
4. an effect of cytoplasm on functioning of DNA

• Cistron is

1. The coding sequence of DNA 9
2. The functional unit of DNA molecule that codes for a particular gene product
3. Intervening non coding sequence of DNA
4. The sequences which are removed during RNA splicing.

• The coding sequences found in split genes are called 11

1. Operons
2. Introns
3. Exons
4. Cistrons

• Segregation of genes occurs in

1. Embryo formation
2. Anaphase II
3. Anaphase I
4. Metaphase II

• The removal of which enzyme affects the synthesis of hnRNA in eukaryotes

1. RNA polymerase II
2. RNA primase
3. RNA polymerase III
4. RNA polymerase I

• Sickle cell anemia is caused

1. When valine is replaced by glutamic acid in beta polypeptide chain
2. When glutamic acid is replaced by valine in beta polypeptide chain
3. When glutamic acid is replaced by valine in alpha polypeptide chain
4. When valine is replaced by glutamic acid in alpha polypeptide chain

• Wobble position means

1. Base paring
2. altered base on code
3. third altered base on codon
4. none of the above

• Peptidyl transferase

1. Is a 23s rRNA
2. forms peptide bonds
3. component of ribosome
4. all the three

• Which mRNA will be translated to a polypeptide chain containing 8 amino acids? 16

1. AUGUUAAUAGACGAGUAGCGACGAUGU
2. AUGAGACGGACUGCAUUCCCAACCUGA
3. AUGCCCAACCGUUAUUCAUGCUAG
4. AUGUCGACAGUCUAAAACAGCGGG

• Select the incorrect statement out of the five given below about lac operon when Lactose is present in the medium.

1. Gene-A gets transcribed into mRNA which produces β-galactoside permease
2. Inducer-Repressor complex is formed
3. Lactose inactivates repressor protein
4. RNA polymerase transcribe Z-gene, Y-gene and A-gene
5. Allolactose is the inducer of lac operon

• The transcription initiation factor associated with the RNA polymerase holoenzyme in prokaryotes is

1. β
2. ω
3. σ
4. Αi

• Pick the right difference between a DNA and RNA

1. Sugar and phosphate
2. sugar and purines
3. purines and phosphate
4. sugar and pyrimidines

• The structural genes of lac operon transcribe mRNA which is

1. Polycistronic
2. Replicative
3. Monokaryotic
4. Monocistronic

• If the sequence of bases in DNA is TACCGACCA, then the sequence of codons on the transcript will be

1. ATGGCTGGT
2. ATCCGAACU
3. AUGGCUGGU
4. AUGGACUAA

• Match the following

Column I                                                                                               Column II (A) (A)Helicase                                                   (M) activation of amino acid

(B) Peptidyl transferase                             (N) joins DNA fragments

(C) DNA polymerase                                   (O) unwinds DNA helix

(D) DNA ligase amino acids                      (P) peptide bonds between                           

(E) Aminoacyl synthetase enzyme           (Q) DNA synthesis

(F) RNA primase                                          (R) synthesis of RNA primer

1. A-O, B-P, C-Q, D-N, E-M, F-R
2. A-R, B-M, C-N, D-Q, E-P, F-O
3. A-M, B-R, C-P, D-Q, E-N, F-O
4. A-R, B- Q, C- A, D- M, E-P, F-N

• Genes which are active all the time synthesizing substances needed by the cell are called

1. Cellular luxury genes
2. metabolic genes
3. housekeeping genes
4. control genes

• “Father of experimental Genetics”

1. Gregor Mendel
2. H.Morgan
3. Hugo deVries
4. Carl Correns

• Which of the following condition is called monosomics

1. 2n+1
2. 2n+2
3. 2n-1
4. n+1

• Nullisomic refers to:

1. An individual having one pair of extra chromosomes in diploid complement
2. An individual having one extra chromosome in the diploid set of chromosomes
3. The absence of a chromosome pair from a diploid set
4. An individual lacking one chromosome from a diploid set
5. Both A & B

• A phenomenon of a single gene regulating several phenotypes is called

1. Multiple allelism
2. Pleiotropy
3. Incomplete dominance
4. Co-dominance
5. Mutation

• Turner’s syndrome is

1. XO
2. XXY
3. XXX
4. XYY
5. YYY

• In birds, females are

1. XX
2. ZZ
3. ZO
4. ZW
5. XZ

• X – linked recessive gene is

1. Always expressed in male
2. Always expressed in female
3. Never expressed in males
4. Always expressed in males and female

• Which one is an example for chromosomal mutation

1. Sickle cell anemia
2. Muscular dystrophy
3. Phenylketoneuria
4. Klinefelter’s syndrome

• Most new mutations appear to be:

1. Beneficial
2. neutral or deleterious
3. present in homozygotes rather than heterozygotes
4. detectable using allozyme studies (protein electrophoresis)
5. present within pericentric inversions

• Indicate, the inheritance of which of the following is controlled by multiple alleles

1. Colour blindness
2. Sickle cell anemia
3. Blood group
4. Phenylketoneuria

• Child has blood group “O” and his father is “B” type. Then genotype of the father should be

1. IB I B
2. IB I O
3. IA I B
4. IOI O

• Erythroblastosis foetalis occurs when

1. Mother is Rh negative and father is Rh positive
2. Father is Rh negative and mother is Rh positive
3. Both are Rh positive
4. Both are Rh negative

• A holandric gene cause hypertrichosis. When a man with hypertrichosis marries a normal woman, what percentage of their daughters would be expected to have hypertrichosis?

1. 50%
2. 25%
3. 75%
4. 0%

• In Snapdragon two plants with pink flowers were hybridized. The F1 plants produced red, pink and white flowers in the proportion of 1 red, 2 pink and 1 white. What could be the genotype of the two plants used for hybridization? Red flower colour is determined by RR and white by rr genes.

1. Rr
2. Rr
3. Rrr
4. RR

• Test cross is a cross between

1. Hybrid x Dominant parent
2. Hybrid x Recessive parent
3. Hybrid x Hybrid
4. Dominant parent x Recessive parent

• Match the following organism with the type of sex determination found in them

Column I                                                                                        Column II

A) ZW-ZZ type                                                                                M) Grasshopper

B) ZO-ZZ                                                                                          N) Drosophila

C)XX-XO                                                                                          O) Hen

D) XX-XY                                                                                         P) Butterfly

1. 1. A-M, B-P, C- O, D-N
   2. A-O, B- N, C-M, D- P
   3. A-O, B-P, C-M, D-N
   4. A- N, B-P, C-M, D- O

• Which is the false statement?

1. Sickle cell anemia is a recessive autosomal disorder
2. Phenylketonuria is a recessive allosomal disorder
3. Haemophilia is a recessive sex linked disorder
4. Colour blindness is a recessive allosome linked disorder

• The percentage of human genome which encodes proteins is approximately

1. Less than 2%
2. 5%
3. 25%
4. 99%

• Read the statements given below and identify the incorrect statement.

1. The human genome contains 3164.7 million nucleotide bases.
2. The average gene consists of 30,000 bp
3. The total number of genes is estimated at 30,000.
4. Chromosome Y has 231 genes e) Less than 2% of the genome codes for proteins.

• Arrange the following events in the order of synthesis of a protein

i) A peptide bond forms

ii) A tRNA matches its anticodon to the codon in the A- site

iii) The movement of second tRNA complex from A-site to P-site

iv) The large subunit attaches to the small subunit and the initiator tRNA fits in the P-site

v) A small subunit binds to the mRNA

vi) The activated amino acid tRNA complex attaches the initiation codon on mRNA

1. iv, v, iii, ii, i, vi
2. iv, vi, v, ii, I, iii
3. v, iv, iii, ii, vi, I
4. v, vi, iv, ii, i, iii

See also…
MCQ ON AGRONOMY- PART 1
MCQ ON GENETICS- PART 2
MCQ ON GENETICS & PLANT BREEDING- PART1